Quadruplex.org
Home Forum Conferences About Quadruplexes QuadDB · Quadparser · Data browse · Data search · Data download · DAS QuadPredict · Tm predict · Data view · Data entry Literature reviews Solved structures Links Research Groups Mailing List Contact	Solved G-quadruplex Structures Id NDB Link PDB Link Description Molecular Description Exp Info Note Citation Year 1QYK NDB PDB GCATGCT + Barium 5'-d(GCATGCT)-3' X-Ray Cardin, C.J., Gan, Y., Thorpe, J.H., Teixeira, S.C.M., Gale, B.C., Moraes, M.I.A. Metal Ion Distribution and Stabilization of the DNA Quadruplex Structure Formed by d(GCATGCT) To be published. - 1QYL NDB PDB GCATGCT + Vanadium 5'-d(GCATGCT)-3' X-Ray Cardin, C.J., GAN, Y., Thorpe, J.H., Teixeira, S.C.M., Gale, B.C., Moraes, M.I.A. Metal Ion Distribution and Stabilisation of the DNA Quadruplex Structure Formed by d(GCATGCT) To be Published. - 1QZL NDB PDB GCATGCT + Cobalt 5'-d(GCATGCT)-3' X-Ray Cardin, C.J., Gan, Y., Thorpe, J.H., Teixeira, S.C.M., Gale, B.C., Moraes, M.I.A. Metal Ion Distribution and Stabilisation of the DNA Quadruplex Structure Formed by d(GCATGCT) To be published. - 1R2O NDB PDB d(GCATGCT) + Ni2+ 5'-d(GCATGCT)-3' X-Ray Cardin, J.C., Gan, Y., Thorpe, J.H., Teixeira, S.C.M., Gale, B.C., Moraes, M.I.A. Metal Ion Distribution and Stabilization of the DNA Quadruplex Structure Formed by d(GCATGCT) To be published. - 2GWE NDB PDB Crystal structure of D(G4T4G4) with six quadruplexes in the asymmetric unit. 5'-d(GGGGTTTTGGGG)-3' X-Ray Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S. Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit. To be Published. - 2GWQ NDB PDB Crystal structure of D(G4T4G4) with four quadruplexes in the asymmetric unit. 5'-d(GGGGTTTTGGGG)-3' X-Ray Lee, M.P.H., Haider, S., Parkinson, G.N., Neidle, S. Crystal structure of D(G4T4G4) with four and six quadruplexes in the asymmetric unit. To be Published. - 2K8Z NDB PDB Dimeric solution structure of the DNA loop d(TCGTTGCT) 5'-d(TCGTTGCT)-3' NMR Viladoms J, Escaja N, Frieden M, Gomez-Pinto I, Pedroso E, Gonzalez C, Self-association of short DNA loops through minor groove C:G:G:C tetrads. Nucleic Acids Res., 37, pp. 3264 - 3275, 2009. 2009 2K90 NDB PDB Dimeric solution structure of the DNA loop d(TGCTTCGT) 5'-d(TGCTTCGT)-3' NMR Viladoms J, Escaja N, Frieden M, Gomez-Pinto I, Pedroso E, Gonzalez C, Self-association of short DNA loops through minor groove C:G:G:C tetrads. Nucleic Acids Res., 37, pp. 3264 - 3275, 2009. 2009 2K97 NDB PDB Dimeric solution structure of the cyclic octamer d(pCGCTCCGT) 5'-d(CGCTCCGT)-3' NMR Viladoms J, Escaja N, Frieden M, Gomez-Pinto I, Pedroso E, Gonzalez C, Self-association of short DNA loops through minor groove C:G:G:C tetrads. Nucleic Acids Res., 37, pp. 3264 - 3275, 2009. 2009 2KAZ NDB PDB Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the connecting loop 5'-d(GGGACGTAGTGGG)-3' NMR Balkwill GD, Garner TP, Williams HE, Searle MS., Folding topology of a bimolecular DNA quadruplex containing a stable mini-hairpin motif within the diagonal loop J.Mol.Biol., 385, pp. 1600 - 1615, 2009. 2009 2KBP NDB PDB Solution structure of a G-quadruplex of human telomeric RNA 5'-r(UAGGGUUAGGGU)-3' NMR Martadinata H, and Phan AT., Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric RNA sequences in K+ solution. J.Am.Chem.Soc., 131, pp. 2570 - 2578, 2009. 2009 2KF7 NDB PDB Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution (with G7-to-BRG substitution) Human telomere DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT, Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers J.Am.Chem.Soc., 131, pp. 4301 - 4309, 2009. 2009 2KF8 NDB PDB Structure of a two-G-tetrad basket-type intramolecular G-quadruplex formed by human telomeric repeats in K+ solution Human telomere DNA NMR Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel DJ, Luu KN, Phan AT, Structure of the human telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers J.Am.Chem.Soc., 131, pp. 4301 - 4309, 2009. 2009 3EM2 NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6038 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3EQW NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6042 in small unit cell 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3ERU NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6045 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3ES0 NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6048 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3ET8 NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6054 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3EUI NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6042 in a large unit cell 5'-d(GGGGTTTTGGGG)-3' X-Ray Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3EUM NDB PDB A bimolecular anti-parallel-stranded Oxytricha nova telomeric quadruplex in complex with a 3,6-disubstituted acridine BSU-6066 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Campbell NH, Patel M, Tofa AB, Ghosh R, Parkinson GN, Neidle S., Selectivity in Ligand Recognition of G-Quadruplex Loops. Biochemistry, 48, pp. 1675 - 1680, 2009. 2009 3CCO NDB PDB Bimolecular quadruplex sequence 5'-d(TAGGGTTAGGGT)-3' X-Ray Parkinson, G.N., Cuenca, F. & Neidle, S., Topology Conservation and Loop Flexibility in Quadruplex-drug Recognition: Crystal Structures of Inter- and Intramolecular Telomeric DNA Quadruplex-drug Complexes, Journal of Molecular Biology, 381(5), pp.1145-56, 2008. 2008 3CDM NDB PDB Intramolecular quadruplex sequence 5'-d(TAGGG(TTAGGG)3)-3' X-Ray Parkinson, G.N., Cuenca, F. & Neidle, S., Topology Conservation and Loop Flexibility in Quadruplex-drug Recognition: Crystal Structures of Inter- and Intramolecular Telomeric DNA Quadruplex-drug Complexes, Journal of Molecular Biology, 381(5), pp.1145-56, 2008. 2008 3CE5 NDB PDB A bimolecular parallel-stranded human telomeric quadruplex in complex with a 3,6,9-trisubstituted acridine ligand BRACO-19. 5'-d(TAGGGTTAGGGT)-3' X-Ray Ligand Campbell, N.H., Parkinson, G.N., Reszka, A.P., Neidle, S. Structural basis of DNA quadruplex recognition by an acridine drug. J.Am.Chem.Soc. , 130, pp. 6722 - 6724, 2008. 2008 2E4I NDB PDB Human Telomeric DNA mixed-parallel/antiparallel quadruplex under Physiological Ionic Conditions Stabilized by Proper Incorporation of 8-Bromoguanosines 5'-d(A(BGM)GGTTA(BGM)GGTTA(BGM)(BGM)GTTA(BGM)GG)-3' NMR Matsugami, A., Xu, Y., Noguchi, Y., Sugiyama, H., Katahira, M. Structure of a human telomeric DNA sequence stabilized by 8-bromoguanosine substitutions, as determined by NMR in a K+ solution Febs J., 274, pp. 3545 - 3556, 2007. 2007 2HY9 NDB PDB Solution structure of the human telomeric quadruplex 5'-d(AAAGGGTTAGGGTTAGGGTTAGGGAA)-3' NMR Dai, J., Punchihewa, C., Ambrus, A., Chen, D., Jones, R.A., Yang, D. Structure of the intramolecular human telomeric G-quadruplex in potassium solution: a novel adenine triple formation. Nucleic Acids Res. , 35, pp. 2440 - 2450, 2007. 2007 2JPZ NDB PDB Structure of the hybrid-2 type intramolecular human telomeric G-quadruplex 5'-d(TTAGGGTTAG GGTTAGGGTT AGGGTT)-3' NMR Dai, J., Carver, M., Punchihewa, C., Jones, R.A., Yang, D. Structure of the Hybrid-2 type intramolecular human telomeric G-quadruplex in K+ solution: insights into structure polymorphism of the human telomeric sequence Nucleic Acids Res., 35, pp. 4927 - 4940, 2007. 2007 2JT7 NDB PDB NMR solution structure of the 4:1 distamycin A/[d(TGGGGT)]4 complex 5'-d(TGGGGT)-3' NMR Ligand Martino, L., Virno, A., Pagano, B., Virgilio, A., Di Micco, S., Galeone, A., Giancola, C., Bifulco, G., Mayol, L., Randazzo, A. Structural and thermodynamic studies of the interaction of distamycin A with the parallel quadruplex structure [d(TGGGGT)]4 J.Am.Chem.Soc. , 129, pp. 16048 - 16056, 2007. 2007 2JWQ NDB PDB G-quadruplex recognition by quinacridines: a SAR, NMR and Biological study 5'-d(TTAGGGT)-3' NMR Ligand Hounsou, C., Guittat, L., Monchaud, D., Jourdan, M., Saettel, N., Mergny, J.L., Teulade-Fichou, M. G-Quadruplex Recognition by Quinacridines: a SAR, NMR, and Biological Study ChemMedChem , 2, pp. 655 - 666, 2007. 2007 2O3M NDB PDB Monomeric G-DNA tetraplex from human C-kit promoter 5'-d(AGGGAGGGCGCTGGGAGGAGGG)-3' NMR Phan, A.T., Kuryavyi, V.V., Burge, S., Neidle, S., Patel, D.J. Structure of an unprecedented G-quadruplex scaffold in the human c-kit promoter. J.Am.Chem.Soc., 129, pp. 4386 - 4392, 2007. 2007 2GW0 NDB PDB A d(TGGGGT)- sodium and calcium complex. 5'-d(TGGGGT)-3' X-Ray Lee, M.P., Parkinson, G.N., Hazel, P., Neidle, S. Observation of the coexistence of sodium and calcium ions in a DNA G-quadruplex ion channel. J.Am.Chem.Soc., 129, pp. 10106 - 10107, 2007. 2007 2HRI NDB PDB A parallel stranded human telomeric quadruplex in complex with the porphyrin TMPyP4 5'-d(TAGGGTTAGGG)-3' X-Ray Ligand Parkinson, G.N., Ghosh, R., Neidle, S. Structural basis for binding of porphyrin to human telomeres. Biochemistry, 46, pp. 2390 - 2397, 2007. 2007 2O4F NDB PDB Structure of a parallel-stranded guanine tetraplex crystallised with monovalent ions 5'-d(TGGGGT)-3' X-Ray Creze, C., Rinaldi, B., Haser, R., Bouvet, P., Gouet, P.Structure of a d(TGGGGT) quadruplex crystallized in the presence of Li[+] ions Acta Crystallogr.,Sect.D , 63, pp. 682 - 688, 2007. 2007 2CHJ NDB PDB NMR structure of TGLGLT quadruplex 5'-d((T)G)-r((LCG))-d(G)-r((LCG))-d((T))-3' NMR Nielsen, J.T., Arar, K., Petersen, M. NMR solution structures of LNA (locked nucleic acid) modified quadruplexes. Nucleic Acids Res., 34, pp. 2006 - 2014, 2006. 2006 2CHK NDB PDB NMR structure of TLLLLT quadruplex 5'-d((T))-r((LCG)(LCG)(LCG)(LCG))-d((T))-3' NMR Nielsen, J.T., Arar, K., Petersen, M. NMR solution structures of LNA (locked nucleic acid) modified quadruplexes. Nucleic Acids Res., 34, pp. 2006 - 2014, 2006. 2006 2F8U NDB PDB Solution structure of G-quadruplex formed in the human Bcl-2 promoter 5'-d(GGGCGCGGGAGGAATTGGGCGGG)-3' NMR Dai, J., Chen, D., Jones, R.A., Hurley, L.H., Yang, D. NMR solution structure of the major G-quadruplex structure formed in the human BCL2 promoter region. Nucleic Acids Res. , 34, pp. 5133 - 5144, 2006. 2006 2GKU NDB PDB Monomeric human telomere DNA tetraplex with 3+1 strand fold topology, two edgewise loops and double-chain reversal loop, NMR, 12 structures 5'-d(TTGGGTTAGGGTTAGGGTTAGGGA)-3' NMR Luu, K.N., Phan, A.T., Kuryavyi, V.V., Lacroix, L., Patel, D.J. Structure of the human telomere in k(+) solution: an intramolecular (3 + 1) g-quadruplex scaffold. J.Am.Chem.Soc., 128, pp. 9963 - 9970, 2006. 2006 2IDN NDB PDB NMR structure of a new modified Thrombin Binding Aptamer containing a 5'-5' inversion of polarity site 3'-d(GGT)-5'-5'-d(TGGTGTGGTTGG)-3' NMR Martino, L., Virno, A., Randazzo, A., Virgilio, A., Esposito, V., Giancola, C., Bucci, M., Cirino, G., Mayol, L. A new modified thrombin binding aptamer containing a 5'-5' inversion of polarity site. Nucleic Acids Res., 34, pp. 6653 - 6662, 2006. 2006 2AVH NDB PDB G4T3G4 dimeric quadruplex structure 5'-d(GGGGTTTGGGG)-3' X-Ray Hazel, P., Parkinson, G.N., Neidle, S. Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex. J.Am.Chem.Soc., 128, pp. 5480 - 5487, 2006. 2006 2AVJ NDB PDB G4(Br)UTTG4 dimeric quadruplex 5'-d(GGGG(BRU)TTGGGG)-3' X-Ray Hazel, P., Parkinson, G.N., Neidle, S. Topology variation and loop structural homology in crystal and simulated structures of a bimolecular DNA quadruplex. J.Am.Chem.Soc., 128, pp. 5480 - 5487, 2006. 2006 2HBN NDB PDB Crystallization of the Tl+-form of the Oxytricha nova G-quadruplex 5'-d(GGGGTTTTGGGG)-3' X-Ray Gill, M.L., Strobel, S.A., Loria, J.P. Crystallization and characterization of the thallium form of the Oxytricha nova G-quadruplex. Nucleic Acids Res. , 34, pp. 4506 - 4514, 2006. 2006 2GRB NDB PDB Crystal Structure of an RNA Quadruplex Containing Inosine-tetrad 5'-r((U33)GIGGU)-3' X-Ray RNA Pan, B., Shi, K., Sundaralingam, M. Crystal structure of an RNA quadruplex containing inosine tetrad: implications for the roles of NH2 group in purine tetrads. J.Mol.Biol., 363, pp. 451 - 459, 2006. 2006 1XAV NDB PDB Solution Structure of the Biologically Relevant G-quadruplex Element in the Human c-MYC Promoter. 5'-d(TGAGGGTGGGTAGGGTGGGTAA)-3' NMR Ambrus, A., Chen, D., Dai, J., Jones, R.A., Yang, D. Solution structure of the biologically relevant G-Quadruplex element in the human c-MYC promoter. Implications for G-quadruplex stabilization. Biochemistry, 44, pp. 2048 - 2058, 2005. 2005 1XCE NDB PDB Helica Structure of DNA by Design: The T(GGGG)T Hexad Alignment 5'-d(GCGGTTGGAT)-3' NMR Webba da Silva, M. Experimental Demonstration of T:(G:G:G):T Hexad and T:A:A:T Tetrad Alignments within a DNA Quadruplex Stem Biochemistry , 44, pp. 3754 - 3764, 2005. 2005 1Y8D NDB PDB Dimeric parallel-stranded tetraplex with 3+1 5' G-tetrad interface, single-residue chain reversal loops and GAG triad in the context of A(GGGG) pentad 5'-d(GGGGTGGGAGGAGGGT)-3' NMR Phan, A.T., Kuryavyi, V.V., Ma, J.-B., Faure, A., Andreola, M.-L., Patel, D.J. An interlocked dimeric parallel-stranded DNA quadruplex: A potent inhibitor of HIV-1 integrase Proc.Natl.Acad.Sci.USA , 102, pp. 634 - 639, 2005. 2005 2A5P NDB PDB Monomeric parallel-stranded DNA tetraplex with snap-back 3+1 3' G-tetrad, single-residue chain reversal loops, GAG triad in the context of GAAG diagonal loop, NMR, 8 struct. 5'-d(TGAGGGTGGIGAGGGTGGGGAAGG)-3' NMR Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J. Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter. Nat.Chem.Biol., 1, pp. 167 - 173, 2005. 2005 2A5R NDB PDB Complex of tetra-(4-n-methylpyridyl) porphin with monomeric parallel-stranded DNA tetraplex, snap-back 3+1 3' G-tetrad, single-residue chain reversal loops, GAG triad in the context of GAAG diagonal loop, C-MYC promoter, NMR, 6 struct. 5'-d(TGAGGGTGGIGAGGGTGGGGAAGG)-3' NMR Ligand Phan, A.T., Kuryavyi, V., Gaw, H.Y., Patel, D.J. Small-molecule interaction with a five-guanine-tract G-quadruplex structure from the human MYC promoter. Nat.Chem.Biol., 1, pp. 167 - 173, 2005. 2005 2AKG NDB PDB Thallium form of the G-quadruplex from Oxytricha Nova, d(G4T4G4)2 5'-d(GGGGTTTTGGGG)-3' NMR Gill, M.L., Strobel, S.A., Loria, J.P. (205)Tl NMR methods for the characterization of monovalent cation binding to nucleic acids J.Am.Chem.Soc. , 127, pp. 16723 - 16732, 2005. 2005 2AQY NDB PDB (3+1) assembly of three human telomeric DNA repeats into an asymmetrical dimeric G-quadruplex 5'-d(G(OIP)GTTAGGGTTAGGGT)-3'/ 5'-d(TAGGG(U))-3' NMR Zhang, N., Phan, A.T., Patel, D.J. (3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex J.Am.Chem.Soc. , 127, pp. 17277 - 17285, 2005. 2005 1RDE NDB PDB NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+ 5'-d(GGTTGGTGTGGTTGG)-3' NMR Mao, X., Marky, L.A., Gmeiner, W.H. NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+. J.Biomol.Struct.Dyn. , 22, pp. 25 - 33, 2004. 2004 1S9L NDB PDB NMR Solution Structure of a Parallel LNA Quadruplex 5'-((TLN)(LCG)(LCG)(LCG)(TLN))-3' NMR LNA Randazzo, A., Esposito, V., Ohlenschlager, O., Ramachandran, R., Mayola, L. NMR solution structure of a parallel LNA quadruplex. Nucleic Acids Res. , 32, pp. 3083 - 3092, 2004. 2004 1U64 NDB PDB The Solution Structure of d(G3T4G4)2 5'-d(GGGTTTTGGGG)-3' NMR Sket, P., Crnugelj, M., Plavec, J. d(G3T4G4) forms unusual dimeric G-quadruplex structure with the same general fold in the presence of K+, Na+ or NH4+ ions. Bioorg.Med.Chem. , 12, pp. 5735 - 5744, 2004. 2004 1V3N NDB PDB Crystal structure of d(GCGAGAGC): the DNA quadruplex structure split from the octaplex 5'-d(G(CBR)GAGAGC)-3' X-Ray Kondo, J., Adachi, W., Umeda, S., Sunami, T., Takenaka, A. Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats Nucleic Acids Res., 32, pp. 2541 - 2549, 2004. 2004 1V3O NDB PDB Crystal structure of d(GCGAGAGC): the DNA quadruplex structure split from the octaplex 5'-d(G(I5C)GAGAGC)-3' X-Ray Kondo, J., Adachi, W., Umeda, S., Sunami, T., Takenaka, A. Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats Nucleic Acids Res., 32, pp. 2541 - 2549, 2004. 2004 1V3P NDB PDB Crystal structure of d(GCGAGAGC): the DNA octaplex structure with I-motif of G-quartet 5'-d(G(I5C)GAGAGC)-3' X-Ray Kondo, J., Adachi, W., Umeda, S., Sunami, T., Takenaka, A. Crystal structures of a DNA octaplex with I-motif of G-quartets and its splitting into two quadruplexes suggest a folding mechanism of eight tandem repeats Nucleic Acids Res., 32, pp. 2541 - 2549, 2004. 2004 1S45 NDB PDB Crystal structure analysis of the DNA quadruplex d(TGGGGT) S1 5'-d(TGGGGT)-3' X-Ray Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A. A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions Nucleic Acids Res. , 32, pp. 1097 - 1102, 2004. 2004 1S47 NDB PDB Crystal structure analysis of the DNA quadruplex d(TGGGGT) S2 5'-d(TGGGGT)-3' X-Ray Caceres, C., Wright, G., Gouyette, C., Parkinson, G., Subirana, J.A. A Thymine tetrad in d(TGGGGT) quadruplexes stabilized with Tl+1/Na+1 ions Nucleic Acids Res. , 32, pp. 1097 - 1102, 2004. 2004 1NP9 NDB PDB Structure of the parallel-stranded DNA quadruplex d(TTAGGGA)4 containing the human telomeric repeat 5'-d(TTAGGGT)-3' NMR Gavathiotis, E., Searle, M.S. Structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 containing the human telomeric repeat: evidence for A-tetrad formation from NMR and molecular dynamics simulations. ORG.BIOMOL.CHEM. , 1, pp. 1650 - 1656, 2003. 2003 1NYD NDB PDB Solution structure of DNA quadruplex GCGGTGGAT 5'-d(GCGGTGGAT)-3' NMR Webba da Silva, M. Association of DNA quadruplexes through G:C:G:C tetrads. Solution structure of d(GCGGTGGAT). Biochemistry , 42, pp. 14356 - 14365, 2003. 2003 1NZM NDB PDB NMR structure of the parallel-stranded DNA quadruplex d(TTAGGGT)4 complexed with the telomerase inhibitor RHPS4 5'-d(TTAGGGT)-3' NMR Ligand Gavathiotis, E., Heald, R.A., Stevens, M.F.G., Searle, M.S. Drug Recognition and Stabilisation of the Parallel-stranded DNA Quadruplex d(TTAGGGT)4 Containing the Human Telomeric Repeat J.Mol.Biol. , 334, pp. 25 - 36, 2003. 2003 1OZ8 NDB PDB Intramolecular higher-order packing of parallel quadruplexes comprising a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad of GGA triplet repeat DNA 5'-d(GGAGGAGGAGGAGGAGGAGGAGGA)-3' NMR Matsugami, A., Okuizumi, T., Uesugi, S., Katahira, M. Intramolecular Higher Order Packing of Parallel Quadruplexes Comprising a G:G:G:G Tetrad and a G(:A):G(:A):G(:A):G Heptad of GGA Triplet Repeat DNA J.BIOL.CHEM. , 278, pp. 28147 - 28153, 2003. 2003 1L1H NDB PDB Crystal Structure of the Quadruplex DNA-Drug Complex 5'-d(GGGGTTTTGGGG)-3' X-Ray Ligand Haider, S.M., Parkinson, G.N., Neidle, S. Structure of a G-quadruplex-Ligand Complex J.Mol.Biol. , 326, pp. 117 - 125, 2003. 2003 1O0K NDB PDB Structure of the First Parallel DNA Quadruplex-drug Complex 5'-d(TGGGGT)-3' X-Ray Ligand Clark, G.R., Pytel, P.D., Squire, C.J., Neidle, S. Structure of the First Parallel DNA Quadruplex-drug Complex J.Am.Chem.Soc. , 125, pp. 4066 - 4067, 2003. 2003 1PA6 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGAGG 5'-d(GGGGTTTTGAGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide shuffling and ssDNA recognition in Oxytricha nova telomere end-binding protein complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH1 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGGGGT 5'-d(GGGGTTTTGGGGT)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH2 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTG 5'-d(GGGGTTTTG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH3 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGGTG 5'-d(GGGGTTTTGGTG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH4 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGGCG 5'-d(GGGGTTTTGGCG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH5 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTG(3DR)GG 5'-d(GGGGTTTTG(3DR)GG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH6 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGTGG 5'-d(GGGGTTTTGTGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH7 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGIGG 5'-d(GGGGTTTTGIGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH8 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGCGG 5'-d(GGGGTTTTGCGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and Ssdna Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PH9 NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GGGGTTTTGAGG 5'-d(GGGGTTTTGAGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1PHJ NDB PDB Crystal structure of the Oxytricha nova telomere end-binding protein complexed with noncognate ssDNA GG(3DR)GTTTTGGGG 5'-d(GG(3DR)GTTTTGGGG)-3' X-Ray Protein Theobald, D.L., Schultz, S.C. Nucleotide Shuffling and ssDNA Recognition in Oxytricha Nova Telomere End-Binding Protein Complexes Embo J. , 22, pp. 4314 - 4324, 2003. 2003 1J6S NDB PDB Crystal Structure of an RNA Tetraplex (UGAGGU)4 with A-tetrads, G-tetrads, U-tetrads and G-U octads 5'-r((BRUGAGGU)-3' X-Ray RNA Pan, B., Xiong, Y., Shi, K., Deng, J., Sundaralingam, M. Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads: implications for specific binding in RNA tetraplexes Structure , 11, pp. 815 - 823, 2003. 2003 1MDG NDB PDB An Alternating Antiparallel Octaplex in an RNA Crystal Structure 5'-r(U(BGM)GAGGU)-3' X-Ray RNA Pan, B.C., Xiong, Y., Shi, K., Sundaralingam, M. An Eight-Stranded Helical Fragment in RNA Crystal Structure: Implications for Tetraplex Interaction Structure , 11, pp. 825 - 831, 2003. 2003 1P79 NDB PDB Crystal structure of a bulged RNA tetraplex: implications for a novel binding site in RNA tetraplex 5'-d(UG)-r(UGGU)-3' X-Ray RNA Pan, B., Xiong, Y., Shi, K., Sundaralingam, M. Crystal Structure of a Bulged RNA Tetraplex at 1.1 A Resolution: Implications for a Novel Binding Site in RNA Tetraplex STRUCTURE , 11, pp. 1423 - 1430, 2003. 2003 1LVS NDB PDB The solution structure of d(G4T4G3)2 5'-d(GGGGTTTTGGG)-3' NMR Crnugelj, M., Hud, N.V., Plavec, J. The solution structure of d(G(4)T(4)G(3))(2): a bimolecular G-quadruplex with a novel fold. J.Mol.Biol. , 320, pp. 911 - 924, 2002. 2002 1MY9 NDB PDB Solution structure of a K+ cation stabilized dimeric RNA quadruplex containing two G:G(:A):G:G(:A) hexads, G:G:G:G tetrads and UUUU loops 5'-r(GGAGGUUUUGGAGG)-3' NMR RNA Liu, H., Matsugami, A., Katahira, M., Uesugi, S. A Dimeric RNA Quadruplex Architecture Comprised of Two G:G(:A):G:G(:A) Hexads, G:G:G:G Tetrads and UUUU Loops J.Mol.Biol., 322, pp. 955 - 970, 2002. 2002 1JPQ NDB PDB Crystal Structure of the Oxytricha Telomeric DNA at 1.6A 5'-d(GGGG(BRU)TTTGGGG)-3' X-Ray Haider, S., Parkinson, G.N., Neidle, S. Crystal structure of the potassium form of an Oxytricha nova G-quadruplex. J.Mol.Biol. , 320, pp. 189 - 200, 2002. 2002 1JRN NDB PDB Orthorhombic form of Oxytricha telomeric DNA at 2.0A 5'-d(GGGGTTTTGGGG)-3' X-Ray Haider, S., Parkinson, G.N., Neidle, S. Crystal structure of the potassium form of an Oxytricha nova G-quadruplex. J.Mol.Biol. , 320, pp. 189 - 200, 2002. 2002 1K8P NDB PDB Structure of the Human G-quadruplex reveals a novel topology 5'-d((BRU)AGGG(BRU)TAGGGT)-3' X-Ray Parkinson, G.N., Lee, M.P., Neidle, S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature , 417, pp. 876 - 880, 2002. 2002 1KF1 NDB PDB Structure and Packing of Human Telomeric DNA 5'-d(AGGGTTAGGGTTAGGGTTAGGG)-3' X-Ray Parkinson, G.N., Lee, M.P., Neidle, S. Crystal structure of parallel quadruplexes from human telomeric DNA. Nature , 417, pp. 876 - 880, 2002. 2002 1I34 NDB PDB Solution DNA quadruplex with double chain reversal loop and two diagonal loops connecting GGGG tetrads flanked by G-(T-T) triad and T-T-T triple 5'-d(GGTTTTGGCAGGGTTTTGGT)-3' NMR Kuryavyi, V., Majumdar, A., Shallop, A., Chernichenko, N., Skripkin, E., Jones, R., Patel, D.J. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple. J.Mol.Biol., 310, pp. 181 - 194, 2001. 2001 1JJP NDB PDB A(GGGG) Pentad-Containing Dimeric DNA Quadruplex Involving Stacked G(anti)G(anti)G(anti)G(syn) Tetrads 5'-d(GGGAGGTTTGGGAT)-3' NMR Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J. V-shaped scaffold: a new architectural motif identified in an A x (G x G x G x G) pentad-containing dimeric DNA quadruplex involving stacked G(anti) x G(anti) x G(anti) x G(syn) tetrads. J.Mol.Biol., 311, pp. 1063 - 1079, 2001. 2001 1JVC NDB PDB Dimeric DNA Quadruplex Containing Major Groove-Aligned A.T.A.T and G.C.G.C Tetrads Stabilized by Inter-Subunit Watson-Crick A:T and G:C Pairs 5'-d(GAGCAGGT)-3' NMR Zhang, N., Gorin, A., Majumdar, A., Kettani, A., Chernichenko, N., Skripkin, E., Patel, D.J. Dimeric DNA quadruplex containing major groove-aligned A-T-A-T and G-C-G-C tetrads stabilized by inter-subunit Watson-Crick A-T and G-C pairs. J.Mol.Biol., 312, pp. 1073 - 1088, 2001. 2001 1MYQ NDB PDB An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction 5'-d(GGAGGAGGAGGA)-3' NMR Matsugami, A., Ouhashi, K., Kanagawa, M., Liu, H., Kanagawa, S., Uesugi, S., Katahira, M. An intramolecular quadruplex of (GGA)(4) triplet repeat DNA with a G:G:G:G tetrad and a G(:A):G(:A):G(:A):G heptad, and its dimeric interaction. J.Mol.Biol., 313, pp. 255 - 269, 2001. 2001 1JB7 NDB PDB DNA G-Quartets in a 1.86 A Resolution Structure of an Oxytricha nova Telomeric Protein-DNA Complex 5'-d(GGGGTTTTGG GG)-3' X-Ray Horvath, M.P., Schultz, S.C. DNA G-quartets in a 1.86 A resolution structure of an Oxytricha nova telomeric protein-DNA complex. J.Mol.Biol., 310, pp. 367 - 377, 2001. 2001 1J8G NDB PDB X-ray analysis of a RNA tetraplex r(UGGGGU)4 at ultra-high resolution 5'-r(UGGGGU)-3' X-Ray RNA Deng, J., Xiong, Y., Sundaralingam, M. X-ray analysis of an RNA tetraplex (UGGGGU)(4) with divalent Sr(2+) ions at subatomic resolution (0.61 A). Proc.Natl.Acad.Sci.USA , 98, pp. 13665 - 13670, 2001. 2001 1C32 NDB PDB Solution structure of a quadruplex forming DNA and its intermidiate 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Bolton, P.H. Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA. Nucleic Acids Res. , 28, pp. 1969 - 1977, 2000. 2000 1C34 NDB PDB Solution structure of a quadruplex forming DNA and its intermidiate 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Bolton, P.H. Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA. Nucleic Acids Res. , 28, pp. 1969 - 1977, 2000. 2000 1C35 NDB PDB Solution structure of a quadruplex forming DNA and its intermidiate 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Bolton, P.H. Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA. Nucleic Acids Res. , 28, pp. 1969 - 1977, 2000. 2000 1C38 NDB PDB Solution structure of a quadruplex forming DNA and its intermidiate 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Bolton, P.H. Structures of the potassium-saturated, 2:1, and intermediate, 1:1, forms of a quadruplex DNA. Nucleic Acids Res. , 28, pp. 1969 - 1977, 2000. 2000 1EEG NDB PDB A(GGGG)A hexad pairing aligment for the d(G-G-A-G-G-A-G) sequence 5'-d(GGAGGA)-3' NMR Kettani, A., Gorin, A., Majumdar, A., Hermann, T., Skripkin, E., Zhao, H., Jones, R., Patel, D.J. A dimeric DNA interface stabilized by stacked A.(G.G.G.G).A hexads and coordinated monovalent cations. J.Mol.Biol., 297, pp. 627 - 644, 2000. 2000 1EVO NDB PDB NMR observation of a novel C-tetrad 5'-d(TGGGCGGT)-3' NMR Patel, P.K., Bhavesh, N.S., Hosur, R.V. NMR observation of a novel C-tetrad in the structure of the SV40 repeat sequence GGGCGG. Biochem.Biophys.Res.Commun., 270, pp. 967 - 971, 2000. 2000 1F3S NDB PDB Solution structure of DNA sequence GGGTTCAGG forms GGGG tetrade and G(C-A) triad. 5'-d(GGGTTCAGG)-3' NMR Kettani, A., Basu, G., Gorin, A., Majumdar, A., Skripkin, E., Patel, D.J. A two-stranded template-based approach to G.(C-A) triad formation: designing novel structural elements into an existing DNA framework. J.Mol.Biol., 301, pp. 129 - 134, 2000. 2000 1EMQ NDB PDB NMR observation of T-tetrads in a parallel stranded dna quadruplex formed by Saccharomyces cerevisiae telomere repeats 5'-d(TGGTGGC)-3' NMR Patel, P.K., Hosur, R.V. NMR observation of T-tetrads in a parallel stranded DNA quadruplex formed by Saccharomyces cerevisiae telomere repeats. Nucleic Acids Res., 27, pp. 2457 - 2464, 1999. 1999 1EVM NDB PDB NMR observation of A-tetrad 5'-d(AGGGT)-3' NMR Patel, P.K., Koti, A.S., Hosur, R.V. NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad. Nucleic Acids Res., 27, pp. 3836 - 3843, 1999. 1999 1EVN NDB PDB NMR observation of A-tetrad 5'-d(AGGGT)-3' NMR Patel, P.K., Koti, A.S., Hosur, R.V. NMR studies on truncated sequences of human telomeric DNA: observation of a novel A-tetrad. Nucleic Acids Res., 27, pp. 3836 - 3843, 1999. 1999 1K4X NDB PDB Potassium form of oxy-1.5 quadruplex DNA 5'-d(GGGGTTTTGGGG)-3' NMR Schultze, P., Hud, N.V., Smith, F.W., Feigon, J. The effect of sodium, potassium and ammonium ions on the conformation of the dimeric quadruplex formed by the Oxytricha nova telomere repeat oligonucleotide d(G(4)T(4)G(4)). Nucleic Acids Res., 27, pp. 3018 - 3028, 1999. 1999 1A8N NDB PDB Solution structure of a Na+ cation stabilized DNA quadruplex containing GGGG and GCGC tetrads formed by GGGC repeats observed in AAV and human chromosome 19, NMR 8 structures 5'-d(GGGCTTTTGGGC)-3' NMR Kettani, A., Bouaziz, S., Gorin, A., Zhao, H., Jones, R.A., Patel, D.J. Solution structure of a Na cation stabilized DNA quadruplex containing G.G.G.G and G.C.G.C tetrads formed by G-G-G-C repeats observed in adeno-associated viral DNA. J.Mol.Biol., 282, pp. 619 - 636, 1998. 1998 1A8W NDB PDB A K+ cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats NMR, 8 structures 5'-d(GGGCTTTTGGGC)-3' NMR Bouaziz, S., Kettani, A., Patel, D.J. A K cation-induced conformational switch within a loop spanning segment of a DNA quadruplex containing G-G-G-C repeats. J.Mol.Biol., 282, pp. 637 - 652, 1998. 1998 1AFF NDB PDB DNA quadruplex containing GGGG tetrads and (T.A).A triads, NMR, 8 structures 5'-d(TAGG)-3' NMR Kettani, A., Bouaziz, S., Wang, W., Jones, R.A., Patel, D.J. Bombyx mori single repeat telomeric DNA sequence forms a G-quadruplex capped by base triads. Nat.Struct.Biol., 4, pp. 382 - 389, 1997. 1997 352D NDB PDB The crystal structure of a parallel-stranded parallel-stranded guanine tetraplex at 0.95 angstrom resolution 5'-d(TGGGGT)-3' X-Ray Phillips, K., Dauter, Z., Murchie, A.I., Lilley, D.M., Luisi, B. The crystal structure of a parallel-stranded guanine tetraplex at 0.95 A resolution. J.Mol.Biol. , 273, pp. 171 - 182, 1997. 1997 1QDF NDB PDB The NMR study of dna quadruplex structure, aptamer (15mer) DNA 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin. J.Mol.Biol., 260, pp. 378 - 394, 1996. 1996 1QDH NDB PDB The NMR study of dna quadruplex structure, aptamer (15mer) DNA 5'-d(GGTTGGTGTGGTTGG)-3' NMR Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin. J.Mol.Biol., 260, pp. 378 - 394, 1996. 1996 1QDI NDB PDB The NMR study of dna quadruplex structure, (12mer) DNA 5'-d(GGGGTTTTGGGG)-3' NMR Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin. J.Mol.Biol., 260, pp. 378 - 394, 1996. 1996 1QDK NDB PDB The NMR study of dna quadruplex structuRE, (12mer) DNA 5'-d(GGGGTTTTGGGG)-3' NMR Marathias, V.M., Wang, K.Y., Kumar, S., Pham, T.Q., Swaminathan, S., Bolton, P.H. Determination of the number and location of the manganese binding sites of DNA quadruplexes in solution by EPR and NMR in the presence and absence of thrombin. J.Mol.Biol., 260, pp. 378 - 394, 1996. 1996 1HAP NDB PDB Complex of human alpha-thrombin with a 15mer oligonucleotide GGTTGGTGTGGTTGG (based on X-ray model of DNA) 5'-d(GGTTGGTGTGGTTGG)-3' X-Ray Protein Padmanabhan, K., Tulinsky, A. An ambiguous structure of a DNA 15-mer thrombin complex. Acta Crystallogr.,Sect.D , 52, pp. 272 - 282, 1996. 1996 1HAO NDB PDB Complex of human alpha-thrombin with a 15mer oligonucleotide GGTTGGTGTGGTTGG (based on NMR model of DNA) 5'-d(GGTTGGTGTGGTTGG)-3' X-Ray Protein Padmanabhan, K., Tulinsky, A. An ambiguous structure of a DNA 15-mer thrombin complex. Acta Crystallogr.,Sect.D , 52, pp. 272 - 282, 1996. 1996 1FQP NDB PDB Intramolecular quadruplex DNA with three GGGG repeats, NMR, ph 6.7, 0.1 m Na+ and 4 mm (strand concentration), 5 structures 5'-d(GGGTTTTGGG)-3' NMR Keniry, M.A., Strahan, G.D., Owen, E.A., Shafer, R.H. Solution structure of the Na+ form of the dimeric guanine quadruplex [d(G3T4G3)]2. Eur.J.Biochem., 233, pp. 631 - 643, 1995. 1995 230D NDB PDB Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats 5'-d(GGGGTUTUGG GGTTTTGGGG UUTTGGGX)-3' NMR Smith, F.W., Schultze, P., Feigon, J. Solution structures of unimolecular quadruplexes formed by oligonucleotides containing Oxytricha telomere repeats. Structure, 3, pp. 997 - 1008, 1995. 1995 148D NDB PDB Three-dimensional solution structure of the thrombin binding dna aptamer d(GGTTGGTGTGGTTGG) 5'-d(GGTTGGTGTGGTTGG)-3' NMR Schultze, P., Macaya, R.F., Feigon, J. Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG). J.Mol.Biol., 235, pp. 1532 - 1547, 1994. 1994 156D NDB PDB Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG) 5'-d(GGGGTTTTGGGG)-3' NMR Schultze, P., Smith, F.W., Feigon, J. Refined solution structure of the dimeric quadruplex formed from the Oxytricha telomeric oligonucleotide d(GGGGTTTTGGGG). Structure , 2, pp. 221 - 233, 1994. 1994 190D NDB PDB Crystal structure of a four-stranded intercalated DNA: d(C4) 5'-d(CCCC)-3' X-Ray Chen L, Cai L, Zhang X, Rich A., Crystal structure of a four-stranded intercalated DNA: d(C4). Biochemistry, 33, pp. 13540 - 13546, 1994. 1994 244D NDB PDB The high-resolution crystal structure of a parallel-stranded guanine tetraplex 5'-d(TGGGGT)-3' X-Ray Laughlan, G., Murchie, A.I., Norman, D.G., Moore, M.H., Moody, P.C., Lilley, D.M., Luisi, B. The high-resolution crystal structure of a parallel-stranded guanine tetraplex. Science , 265, pp. 520 - 524, 1994. 1994 139D NDB PDB Solution structure of a parallel-stranded G-quadruplex DNA 5'-d(TTGGGGT)-3' NMR Wang, Y., Patel, D.J. Solution structure of a parallel-stranded G-quadruplex DNA. J.Mol.Biol. , 234, pp. 1171 - 1183, 1993. 1993 143D NDB PDB Solution structure of the human telomeric repeat d(AG3[T2AG3]3) of the G-quadruplex 5'-d(AGGGTTAGGGTTAGGGTTAGGG)-3' NMR Wang, Y., Patel, D.J. Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure, 1, pp. 263 - 282, 1993. 1993 1RAU NDB PDB Solution structure of an unusually stable RNA tetraplex containing G-and U-quartet structures 5'-r(UGGGGU)-3' NMR RNA Cheong, C., Moore, P.B. Solution structure of an unusually stable RNA tetraplex containing G- and U-quartet structures. Biochemistry , 31, pp. 8406 - 8414, 1992. 1992
Website provided as a service to the quadruplex community by Han-Min Wong, Simon Rodgers and Julian Huppert, University of Cambridge. All rights reserved.