Home Forum Conferences About Quadruplexes QuadDB · Quadparser · Data browse · Data search · Data download · DAS QuadPredict · Tm predict · Data view · Data entry Literature reviews Solved structures Links Research Groups Mailing List Contact

Data search

Searching the database

Search database by Gene

The PQS database may be searched based on a gene of interest (gene id, HGNC, symbol, or description). The result is a list of PQS that found at the promoter region, 5'UTR, or 3'UTR of the gene. Links to relevant Ensembl pages are also provided in the result for easy cross-referencing with the other related data. This search is particularly useful to identify PQS that may be involved in gene regulation.

Search database by PQS

Alternatively, the database can also be searched using the sequence (e.g. GGGTGGGAGGGTGGG) of a PQS of interest. This will search through all PQS found in the entire genome (i.e. not just near a gene). This search is particularly useful to check if a PQS is unique in the genome, and/or to check if a PQS is also found in (for example) the promoter of another gene.

The database

The genomic data used for all species provided here is based on the ENSEMBL Build 49. For any other data builds or species (not listed here) you may download the data set from here.

The putative quadruplex sequences (PQSs) in the database is predicted by using the Quadparser. The Quadparser software is based on the Folding rule, derived from various considerations. The Folding rule states that "A sequence of the form d( G 3+ N1-7 G 3+ N1-7 G 3+ N1-7 G 3+) will fold into a quadruplex under near-physiological conditions.", where 'G' is guianine and 'N' can be of any of the 4 nucleotide. Details on this rule can be found here. However, in order to show all PQSs predicted without having to include redundant data, overlapping PQSs are shown as a single PQS. As such, the data shown are actually in the form d( (G 3+ N1-7)3+ G 3+). Below is a list of PQS examples.

  • GGGACGGGTGGGCGATGCGGG : 1 PQS
  • GGGGTCCGACGGGACAGGGATAGGGATCGGGG : 2 overlapping PQSs
  • GGGTGGGTGGGTGGGTGGGTGGGTGGGTGGG : 5 overlapping or 2 non-overlapping PQSs




Website provided as a service to the quadruplex community by Han-Min Wong, Simon Rodgers and Julian Huppert, University of Cambridge.
All rights reserved.