Help/Details
[Close Help/Details]
Input
You have the option of either (a) Sequence: copy-paste your sequence(s) (in FASTA format) into the given text box or
(b) Upload File: upload a fasta file containing your sequence(s)
| Sequence | Copy-paste your sequence data (in FASTA) format into the text box provided. You may have one or more sequences. To submit, just click on the 'Submit' button |
| Upload File | Click on the 'Browse...' button to locate the file of interest and then submit the file for processing by clicking on the 'Upload' button. |
Advance options
This web service is an implementary of the
Quadparser. The Quadparser software is based on the Folding rule,
derived from various considerations. The Folding rule states
that "A sequence of the form
d( G 3+ N1-7
G 3+ N1-7
G 3+ N1-7
G 3+)
will fold into a quadruplex under near-physiological conditions.", where 'G' is guianine and
'N' can be of any of the 4 nucleotide. Details on this rule can be
found here.
By default, the Quadparser look for sequences (and complementary sequence) that satisfy the form d( (G 3+ N1-7)3+ G 3+).
However, you may also tune Quadparser to suit your needs by changing the following options:
| Bases considered | The bases to be considers for the quadruplex sequence (default: 'GC'). Example: To list G-quadruplex at the positive strand only, use 'G'. |
| Bases repeats | The minimal number of times the base considered has to be repeated in a group. Example: For the sequence form d( (G n+ N1-7)m+ G n+) is n. (default: 3). |
| Repeats in bases sequence | The minimal number of times the sequence of the bases considered has to be repeated. Example: For the sequence form d( (G n+ N1-7)m+ G n+) is m+1. (default: 4). |
| Min gap size | The minimal length of each of the loops. Example: For the sequence form d( (G n+ N1-7)m+ G n+) is 1. (default: 1). |
| Max gap size | The maximum length of each of the loops. Example: For the sequence form d( (G n+ N1-7)m+ G n+) is 7. (default: 7). |
Example
You can try the service by copy-paste the following sequence into the 'Sequence' text box and click on the 'Submit' button.
>test_DNA
GGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGTTAGTCCGATCGACTAGCTAGCTAGGGTGGGTGGGTGGGCC
CTGATCCCATCGACCCATCCCGATAGGAGACAGCTAGCTAGCTAGCTAGCTAGCTACGA
Troubleshooting
- I have uploaded a file but I am not getting any responses. I am not even getting a message saying no PQS found or file size exceeds the limit.
Please verify the size of the file you've uploaded. File sizes that are within our script engine (PHP) allowable size range will be given an error
message if the file size exceeds our configured limit (i.e. not the PHP limit). However, for relatively large file size that exceed the PHP limit
(current around 50MB), the script engine will refuse to upload the file (for web security and stability reasons) and may not display any error message.
[Close Help/Details]
